Nucleic acids

Nucleic acids

The abbreviation DNA (deoxyribonucleic acid) is so well known that it is usually only necessary to spell it out in very technical texts. RNA (ribonucleic acid) is less well known and so, depending on the audience and context, may need to be spelt out at first use.

Bases

Four bases comprise DNA: guanine, cytosine, adenine and thymine. These are abbreviated using the capital letters G, C, A and T. In RNA, the thymine (T) is replaced by uracil (U). Base abbreviations are roman.

Nucleotide sequences

By convention, nucleotide sequences are presented in the 5-prime (5′) to 3-prime (3′) direction. For a single sequence, insert a space after every 5 or 10 symbols:

AATGC CGACC TGTTT AACGA CTAAG TTCCC

If it is necessary to indicate the 5′ and 3′ ends, use a hyphen to link these to the sequence:

5′-UAGCU AACCC UUUUA GGGUC-3′

Caution! The single prime symbol (unicode 2032) cannot be replaced with an apostrophe or with a single quotation mark (see Single prime symbol).

When aligning homologous sequences, use a font (such as Courier New) that uses the same horizontal space for each letter and punctuation mark, and insert hyphens to maintain the alignment:

AATGCCGACCTGTTTAACGACTAAGTTCCC
AAGGCGGACTTGTTACA---CTATTTTCCC

Other conventions and abbreviations

  • bp – base pairs. Use for DNA sequences with fewer than 1,000 base pairs:

The length of DNA sequenced is 325 bp.

  • kbp – kilobase pairs (1,000 base pairs); generally shortened to kilobases (kb):

The sequence is 1.2 kb long.

  • Mbp – megabase pairs (1 million base pairs); generally shortened to megabases (Mb). Use for long sequences or to indicate the total number of bases (similarly for gigabase pairs [Gbp] for 1,000 million base pairs):

The human genome contains about 3,000 Mb, or 3 Gb, of DNA.

  • cM – centimorgans. Use to describe the genetic distance between 2 loci on a chromosome. Note the capital M.
  • DNA and RNA descriptors. Use lower-case letters for descriptors of DNA and RNA:

cDNA [complementary]     ssDNA [single-stranded]     dsDNA [double-stranded]     mtDNA [mitochondrial]     rRNA [ribosomal]     mRNA [messenger]     nDNA [nuclear]     tRNA [transfer]

Return to top

User login

... or purchase now

An individual subscription is only A$60 per year

Group and student discounts may apply

Australian manual of scientific style Start communicating effectively

Purchase